ID: 1110860124

View in Genome Browser
Species Human (GRCh38)
Location 13:80339025-80339047
Sequence GGGGCCGCGGGCGCCTCCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 205}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110860118_1110860124 -4 Left 1110860118 13:80339006-80339028 CCCCAGACTCAGACAGGCGGGGG 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860113_1110860124 8 Left 1110860113 13:80338994-80339016 CCTGCTTACGATCCCCAGACTCA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860108_1110860124 20 Left 1110860108 13:80338982-80339004 CCAGGCTGCCCCCCTGCTTACGA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860120_1110860124 -5 Left 1110860120 13:80339007-80339029 CCCAGACTCAGACAGGCGGGGGC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860111_1110860124 10 Left 1110860111 13:80338992-80339014 CCCCTGCTTACGATCCCCAGACT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860109_1110860124 12 Left 1110860109 13:80338990-80339012 CCCCCCTGCTTACGATCCCCAGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860110_1110860124 11 Left 1110860110 13:80338991-80339013 CCCCCTGCTTACGATCCCCAGAC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860121_1110860124 -6 Left 1110860121 13:80339008-80339030 CCAGACTCAGACAGGCGGGGGCC 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860112_1110860124 9 Left 1110860112 13:80338993-80339015 CCCTGCTTACGATCCCCAGACTC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205
1110860107_1110860124 27 Left 1110860107 13:80338975-80338997 CCATGGGCCAGGCTGCCCCCCTG 0: 1
1: 0
2: 6
3: 55
4: 576
Right 1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG 0: 1
1: 1
2: 2
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110860124 Original CRISPR GGGGCCGCGGGCGCCTCCGA AGG Exonic