ID: 1110861112

View in Genome Browser
Species Human (GRCh38)
Location 13:80345357-80345379
Sequence AAACCAGACCCGCAGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110861112_1110861121 27 Left 1110861112 13:80345357-80345379 CCAGGCTCCTGCGGGTCTGGTTT 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1110861121 13:80345407-80345429 ATCCACCTGGTGATTTTTACTGG 0: 1
1: 0
2: 6
3: 18
4: 93
1110861112_1110861117 3 Left 1110861112 13:80345357-80345379 CCAGGCTCCTGCGGGTCTGGTTT 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1110861117 13:80345383-80345405 CCGGAGGCCTTGTATTCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 69
1110861112_1110861120 14 Left 1110861112 13:80345357-80345379 CCAGGCTCCTGCGGGTCTGGTTT 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1110861120 13:80345394-80345416 GTATTCAACTGGGATCCACCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1110861112_1110861118 4 Left 1110861112 13:80345357-80345379 CCAGGCTCCTGCGGGTCTGGTTT 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1110861118 13:80345384-80345406 CGGAGGCCTTGTATTCAACTGGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110861112 Original CRISPR AAACCAGACCCGCAGGAGCC TGG (reversed) Intergenic
903944348 1:26952229-26952251 AGACCAGACCCCAAGGACCCTGG - Exonic
904891756 1:33784528-33784550 GAATCAGGCTCGCAGGAGCCTGG - Intronic
905060526 1:35135826-35135848 ACACCTGAACCGCAGCAGCCAGG - Intergenic
905960207 1:42036319-42036341 AAACCAAACCCGAATGGGCCAGG + Intergenic
907930024 1:58990595-58990617 AACCTACACCAGCAGGAGCCAGG - Intergenic
908591960 1:65645371-65645393 ACACCTGAACCGCAGCAGCCAGG - Intergenic
911192337 1:94960385-94960407 AGACCAGACCCACAGGCCCCTGG - Intergenic
912519385 1:110234752-110234774 CAACCAGACCCGCCAGAGCCTGG - Intronic
912678199 1:111705915-111705937 AACCCAGCCCCACCGGAGCCTGG - Intronic
913449674 1:118984620-118984642 AGACCAGCCTCGGAGGAGCCTGG - Intronic
916421289 1:164640150-164640172 CATCCAGACCTCCAGGAGCCAGG - Intronic
920035500 1:203062608-203062630 AAACCCCACCAGCAGGAGACTGG + Intronic
921333585 1:214064534-214064556 AAACCAGCCCTGGAAGAGCCTGG - Intergenic
1065401059 10:25301905-25301927 AAATCAGACCAGCAGTTGCCTGG - Intronic
1065825930 10:29571477-29571499 AAGCCAGACTTGCAGCAGCCTGG - Intronic
1067204816 10:44203598-44203620 CAAGCAGAGCAGCAGGAGCCAGG + Intergenic
1067368393 10:45658322-45658344 AAAGCAAACCCCCAGGAGCTGGG + Intronic
1067519283 10:46983792-46983814 AACCCAGAGCAGCAGGGGCCAGG - Intronic
1067642962 10:48068047-48068069 AACCCAGAGCAGCAGGAGCCAGG + Intergenic
1069438365 10:68406754-68406776 AATGCTGACGCGCAGGAGCCTGG - Exonic
1069514454 10:69066454-69066476 GAACCAGAATGGCAGGAGCCAGG + Intergenic
1071509856 10:86254717-86254739 AAAGCAGAGCCGCTGAAGCCTGG + Intronic
1073062814 10:100742416-100742438 AAACCAGGCCGGCAGTAGCTCGG + Intronic
1073510100 10:104037582-104037604 AAAGCAGACCCACAGGAGGAAGG + Intronic
1074395608 10:113095619-113095641 AAAACAGACGCGGAGAAGCCGGG + Intronic
1074936747 10:118189575-118189597 ACACCAGAGCCTCAGCAGCCTGG + Intergenic
1075999803 10:126905603-126905625 ACACCCGCCCCGCCGGAGCCTGG - Intronic
1076219005 10:128718065-128718087 AGACAAGAGCAGCAGGAGCCAGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076806641 10:132862281-132862303 CAACAAGCCCCGCAGGGGCCCGG - Intronic
1079611078 11:22433059-22433081 AAAGCAGACGCGCACTAGCCTGG + Intergenic
1081875278 11:46404307-46404329 AAACCAGAGCTGCAAGAGCATGG - Intronic
1081909553 11:46692188-46692210 AAAGCAGACTGGCAGGGGCCAGG + Intronic
1084371652 11:68749322-68749344 AAGCCAGAGCAGCAGGAGCTTGG - Intronic
1085506500 11:77063873-77063895 AAAACTGACCAGCAGGATCCCGG + Intergenic
1090385744 11:126356612-126356634 AAGCCAGGCCCTCAGGACCCAGG - Intronic
1091760500 12:3084197-3084219 CAGCAAGACCCCCAGGAGCCTGG - Intronic
1092172926 12:6384608-6384630 GAACCAGACCTGCAGGGACCAGG + Exonic
1096493651 12:52026803-52026825 AAACTAGGCCTGCAGGAGCTAGG + Intronic
1096516412 12:52158016-52158038 AAACAAGCCACGCAGAAGCCTGG - Intergenic
1098688451 12:73455908-73455930 ATACCAGATACTCAGGAGCCTGG - Intergenic
1099188709 12:79542074-79542096 ACACCTGAACCGCAGCAGCCAGG + Intergenic
1105913978 13:24895216-24895238 AGAGCAGCCCCGGAGGAGCCCGG + Intronic
1105932655 13:25067363-25067385 GAACCAGACAGGGAGGAGCCTGG - Intergenic
1107684850 13:42886572-42886594 AAACCTGACTCGCAGGTGACTGG - Exonic
1108282072 13:48870620-48870642 ACACCTGAACCGCAGCAGCCAGG - Intergenic
1108952952 13:56115915-56115937 ACACCTGAACCGCAGCAGCCAGG - Intergenic
1110466321 13:75806281-75806303 AGGCCAGACCCGCAGCAGGCAGG - Intronic
1110861112 13:80345357-80345379 AAACCAGACCCGCAGGAGCCTGG - Intergenic
1112927217 13:104690878-104690900 GAACCAGCCCTGCAGAAGCCCGG + Intergenic
1113634249 13:111909172-111909194 CATCTAGACCCGCAGCAGCCGGG + Intergenic
1114764031 14:25350222-25350244 AAAGCAGAGCAGCAGGAGCTGGG - Intergenic
1118706760 14:68487195-68487217 AAACCAAACCTGCTGGAGCCTGG - Intronic
1118747374 14:68784168-68784190 AAACCAGACTCTGAGGAGCCAGG - Intergenic
1122983809 14:105203195-105203217 AGGCCGGTCCCGCAGGAGCCTGG + Intergenic
1124250245 15:28102224-28102246 ATTCCAGACCCGCAGGATCTGGG - Intergenic
1125131521 15:36289138-36289160 ACACCTGAACCGCAGCAGCCAGG - Intergenic
1126882519 15:53114592-53114614 AAAACAATCCAGCAGGAGCCTGG + Intergenic
1128126239 15:65195168-65195190 AAACCAAATTCCCAGGAGCCGGG + Exonic
1132097411 15:98997996-98998018 TAACCAGATCCGCAGGGGCAGGG - Intronic
1132694372 16:1195350-1195372 ACCCCAGCCCCGCAAGAGCCCGG - Intronic
1135190281 16:20348825-20348847 AACCCCGGCCCGCAGGAGCCCGG + Exonic
1142520726 17:502908-502930 AGAAGAGACCCGCTGGAGCCAGG + Intergenic
1144732120 17:17534409-17534431 AAAGCAGATCAGCAGCAGCCTGG + Intronic
1145043044 17:19591073-19591095 AAAGCAGAAGCACAGGAGCCAGG - Intergenic
1146901600 17:36592528-36592550 CAACCAGATGGGCAGGAGCCAGG + Intronic
1147825409 17:43267165-43267187 AAAACAGACCCGGAAGAGACCGG + Intergenic
1148215289 17:45830782-45830804 ACCCCAGACCCCCTGGAGCCTGG + Intronic
1150290760 17:63980322-63980344 AACCCAGCTCCTCAGGAGCCAGG + Intergenic
1152645811 17:81468105-81468127 AACCCTGACCCCCAGGTGCCTGG - Intergenic
1152706598 17:81846755-81846777 CAACCAGACCAGCAGGTGACTGG + Intronic
1153322902 18:3790994-3791016 AAACCACATCTGCGGGAGCCTGG - Intronic
1153551114 18:6262601-6262623 AAATCAGACCCTCAGGGGCTGGG - Intronic
1154123684 18:11671611-11671633 AAACCAGACACCCAGGAGGCAGG - Intergenic
1156248302 18:35325064-35325086 AAACAAGACCAGAAGGAGCCTGG + Intergenic
1157100390 18:44723939-44723961 AAACGAGACCCTCAGGTCCCAGG - Intronic
1158243276 18:55401943-55401965 AAACCAGACCCACAGGAACACGG + Intronic
1159691259 18:71491158-71491180 AAACGAGACCTTCAGGATCCAGG + Intergenic
1161579643 19:5073703-5073725 AAACCAGCCCTCCAGGTGCCTGG - Intronic
1162069916 19:8147418-8147440 CGACCAGGCCAGCAGGAGCCGGG + Exonic
1163818276 19:19481225-19481247 ACACCAGGCCCTCAGGAGCCTGG + Intronic
1164506117 19:28862951-28862973 AAACCAGAGCTGCATGAGCCTGG + Intergenic
1166077390 19:40421449-40421471 AACCCAGACCCGGACGAGCTGGG - Intergenic
1167121519 19:47520191-47520213 AATCCAGACCGGCAGGGGGCGGG - Intergenic
1168277858 19:55286993-55287015 TAACCAGCCCTGCAGGAGCAGGG - Exonic
926237196 2:11054834-11054856 AAACAAGATCTGAAGGAGCCAGG - Intergenic
927054503 2:19356571-19356593 AAACCGGAGCCGGAGGAGCCGGG - Intronic
927493732 2:23538089-23538111 AAAACAGACCAGAAGGAGCAAGG + Intronic
928610254 2:32985557-32985579 AATCCAGACTCTCAGCAGCCAGG - Intronic
932000580 2:67880755-67880777 ATTCCAGACCCTCAGGAGCTGGG + Intergenic
932326165 2:70863274-70863296 GAATCAGACACGGAGGAGCCAGG - Intergenic
932709456 2:74051285-74051307 AAACCAGACCTCCAGGAACTGGG + Intronic
934723797 2:96602003-96602025 AAACCAGTCCCACAGGGTCCTGG - Intronic
935182934 2:100706330-100706352 AAACCAGACACTCTGGAGCCGGG + Intergenic
936226353 2:110657081-110657103 AAAATAAACCCACAGGAGCCAGG - Exonic
938307550 2:130265705-130265727 ACACCAGAGGCTCAGGAGCCAGG + Intergenic
938447782 2:131391137-131391159 ACACCAGAGGCTCAGGAGCCAGG - Intergenic
945361642 2:208901457-208901479 ACACCTGAACCGCAGCAGCCAGG + Intergenic
946023571 2:216658232-216658254 AAACCAGACATCCAGAAGCCAGG + Intronic
946665756 2:222048010-222048032 AAAGCAGACCAGCAGCTGCCTGG - Intergenic
947577713 2:231289688-231289710 CAACTGGTCCCGCAGGAGCCTGG + Intronic
948597025 2:239086661-239086683 AAGACAGAACCGCAGGGGCCCGG - Intronic
948681744 2:239639878-239639900 TGACCAGACCCCCAGGACCCTGG - Intergenic
1170106228 20:12756089-12756111 AAGCCTGAACCGCAGCAGCCAGG + Intergenic
1172113207 20:32559648-32559670 AACCCAGGCCCCCAGGCGCCAGG + Intronic
1173101905 20:40095565-40095587 ACGCCTGAACCGCAGGAGCCAGG + Intergenic
1174356157 20:49999315-49999337 AGCCCAGACCTGGAGGAGCCGGG + Intergenic
1174979581 20:55378417-55378439 ATACCAAACCCACAGGGGCCAGG - Intergenic
1179104824 21:38389610-38389632 AGACCACAGCCTCAGGAGCCTGG + Intronic
1180570958 22:16718218-16718240 ACCCCAGACCGGGAGGAGCCTGG - Intergenic
1182347195 22:29674563-29674585 AAACCAGACCTTCTGCAGCCAGG - Intronic
1182797184 22:32999563-32999585 ATCCCAGACCCCCAGGAGGCTGG + Intronic
1184242952 22:43221076-43221098 AAACCAGACTCGCTGGACCCTGG + Intronic
949190404 3:1243305-1243327 ACACCTGAACCGCAGCAGCCAGG - Intronic
950167917 3:10815799-10815821 AAACAAGACCCGCAGGTGTCTGG + Intergenic
954410768 3:50369966-50369988 AAACCAGAGCAGCAGCTGCCTGG + Intronic
954902752 3:54034005-54034027 ACACCAGACCCACAGCAGCCCGG - Intergenic
956295022 3:67703120-67703142 AAGGCAAACCCGCAGAAGCCAGG + Intergenic
956548997 3:70438356-70438378 ACACCTGAACCGCAGCAGCCAGG - Intergenic
961058854 3:123811448-123811470 AAAATAGAGCCCCAGGAGCCAGG + Intronic
961431960 3:126889894-126889916 AAACCACAAACGCAGGAGCAGGG - Intronic
962205558 3:133431345-133431367 ACACCTGAACCGCAGCAGCCAGG + Intronic
962677930 3:137770149-137770171 GAACCAGAAGCGCAGGAGCTGGG + Intergenic
963734552 3:149004969-149004991 AAATCCGACCTGCATGAGCCTGG - Intronic
965286740 3:166827597-166827619 ACACCTGAACCGCAGCAGCCAGG - Intergenic
966313180 3:178616748-178616770 AAACCAACCCCACAGGAGGCAGG - Intronic
969781292 4:9406256-9406278 AATCCTGACCCCCAGGAGCAGGG + Intergenic
970042081 4:11808489-11808511 ACACCTGAACCGCAGCAGCCAGG + Intergenic
971200133 4:24503223-24503245 ACACCTGAACCGCAGGGGCCAGG + Intergenic
971555110 4:28003634-28003656 AAACCAGACATGCAAGATCCTGG + Intergenic
972794622 4:42402866-42402888 AAACCACACCTGCAGGGGCCAGG - Intergenic
980575644 4:134681404-134681426 ACACCTGAACCGCAGCAGCCAGG - Intergenic
980903930 4:138930084-138930106 ACACCTGAACCGCAGCAGCCAGG + Intergenic
985766104 5:1780277-1780299 ACACCATCCCCACAGGAGCCAGG - Intergenic
987976328 5:25019728-25019750 AAAACAGACCCACATGAACCAGG - Intergenic
989661816 5:43807956-43807978 AAATCAGAACAGCAGGAGACAGG - Intergenic
992735063 5:79711298-79711320 AAAGCAGATCAGCAGCAGCCTGG - Intronic
997898637 5:137742852-137742874 GAACCAGACCCTCAGATGCCTGG + Intergenic
998282092 5:140821807-140821829 AAGCCAGAGCAGCAGGAGCCGGG - Exonic
999532098 5:152475174-152475196 AATCCAGACCCAGAGGAGTCTGG + Intergenic
1001309141 5:170598309-170598331 AGTCCAGACCAGCAGGAACCAGG + Intronic
1002613363 5:180435746-180435768 AAGCCAGACCCGCTGGAGTGGGG + Intergenic
1003563949 6:7206758-7206780 AAACCTGGACGGCAGGAGCCAGG + Intronic
1006259212 6:32854098-32854120 AAAGCAGCCCCGCAGCACCCAGG + Intronic
1006426269 6:33965025-33965047 AAAGCTGGCACGCAGGAGCCTGG + Intergenic
1006580446 6:35074097-35074119 AAGCCAGATCCGCCGGAGACAGG - Intronic
1015414607 6:132934315-132934337 AAACCAGACCTGCAGGGGCAAGG - Intergenic
1018937915 6:168285676-168285698 AGGCCAGACCGCCAGGAGCCAGG + Intergenic
1022100864 7:27168442-27168464 CAACCAGCCTCGCTGGAGCCTGG - Intronic
1023920316 7:44624417-44624439 AAAACAGACCAGCAGCAGCTAGG + Exonic
1024001112 7:45189878-45189900 AAAGCAGGACCGCAGGAGCATGG + Intergenic
1035174377 7:157040005-157040027 AAACCTAACACGCAGGAGGCAGG + Intergenic
1035317700 7:158007117-158007139 ACACCAGTCCTGCTGGAGCCAGG + Intronic
1035406476 7:158601929-158601951 AAGACAGATCTGCAGGAGCCAGG - Intergenic
1035438446 7:158877166-158877188 AATCCGGAACCGCAGGTGCCTGG - Intronic
1035438469 7:158877276-158877298 AATCCGGAACCGCAGGTGCCTGG - Intronic
1036342802 8:7931695-7931717 AATCCTGACCCCCAGGAGCAGGG - Intronic
1036838144 8:12092450-12092472 AATCCTGACCCCCAGGAGCAGGG - Intergenic
1036859934 8:12338698-12338720 AATCCTGACCCCCAGGAGCAGGG - Intergenic
1043232157 8:77816784-77816806 AACACATACCAGCAGGAGCCAGG + Intergenic
1043341565 8:79246341-79246363 CAACCAAACCAGCAGGAGCTGGG + Intergenic
1044417075 8:91950180-91950202 ACACCTGAACCGCAGCAGCCAGG + Intergenic
1049015578 8:139917760-139917782 AAGCCAGGCTGGCAGGAGCCAGG + Intronic
1051619979 9:19040756-19040778 AAAGCAGACCAGCAGTTGCCTGG + Intronic
1052929788 9:34047020-34047042 AAACCAGAGCAGCAGGAAACAGG + Intronic
1061115107 9:128605382-128605404 AAACCAGGCCTGGAGCAGCCTGG + Exonic
1062228123 9:135465404-135465426 GACCCAGACCAGCAGGAGCACGG + Intergenic
1185960696 X:4543981-4544003 ACACCTGAACCGCAGCAGCCAGG - Intergenic
1189200974 X:39195387-39195409 AAGCCAGACAGGCAGGAGGCAGG + Intergenic
1190391108 X:49932594-49932616 TAACCAAACCCTCAGGGGCCTGG - Intronic
1196799666 X:119531296-119531318 ACACCAGCCCAGCAGGAGCTTGG - Intergenic
1199489133 X:148379511-148379533 AACCCAGACCCTCAGAAACCTGG + Intergenic
1199601650 X:149544696-149544718 AAGCCAGACACGCAGGAGGCTGG + Intronic
1199648727 X:149934787-149934809 AAGCCACACACGCAGGAGGCTGG - Intronic
1200256702 X:154586188-154586210 AGAGCTGGCCCGCAGGAGCCTGG + Exonic
1200261067 X:154618215-154618237 AGAGCTGGCCCGCAGGAGCCTGG - Exonic