ID: 1110864916

View in Genome Browser
Species Human (GRCh38)
Location 13:80382875-80382897
Sequence TGTGCTGCTGGATTCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864916_1110864920 0 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864920 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
1110864916_1110864921 1 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864921 13:80382899-80382921 CAGCCACCATAGGACACTGTGGG No data
1110864916_1110864918 -9 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864918 13:80382889-80382911 AGCAGCACACCAGCCACCATAGG No data
1110864916_1110864924 7 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864924 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
1110864916_1110864925 8 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864925 13:80382906-80382928 CATAGGACACTGTGGGTAAAGGG No data
1110864916_1110864927 17 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864927 13:80382915-80382937 CTGTGGGTAAAGGGGAGACCTGG No data
1110864916_1110864929 23 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864929 13:80382921-80382943 GTAAAGGGGAGACCTGGGCATGG No data
1110864916_1110864926 9 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864926 13:80382907-80382929 ATAGGACACTGTGGGTAAAGGGG No data
1110864916_1110864930 26 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864930 13:80382924-80382946 AAGGGGAGACCTGGGCATGGTGG No data
1110864916_1110864928 18 Left 1110864916 13:80382875-80382897 CCTGAGCTGAATCCAGCAGCACA No data
Right 1110864928 13:80382916-80382938 TGTGGGTAAAGGGGAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864916 Original CRISPR TGTGCTGCTGGATTCAGCTC AGG (reversed) Intergenic