ID: 1110864917

View in Genome Browser
Species Human (GRCh38)
Location 13:80382887-80382909
Sequence TATGGTGGCTGGTGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864917_1110864925 -4 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864925 13:80382906-80382928 CATAGGACACTGTGGGTAAAGGG No data
1110864917_1110864926 -3 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864926 13:80382907-80382929 ATAGGACACTGTGGGTAAAGGGG No data
1110864917_1110864927 5 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864927 13:80382915-80382937 CTGTGGGTAAAGGGGAGACCTGG No data
1110864917_1110864930 14 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864930 13:80382924-80382946 AAGGGGAGACCTGGGCATGGTGG No data
1110864917_1110864924 -5 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864924 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
1110864917_1110864929 11 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864929 13:80382921-80382943 GTAAAGGGGAGACCTGGGCATGG No data
1110864917_1110864932 26 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data
1110864917_1110864928 6 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864928 13:80382916-80382938 TGTGGGTAAAGGGGAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864917 Original CRISPR TATGGTGGCTGGTGTGCTGC TGG (reversed) Intergenic