ID: 1110864919

View in Genome Browser
Species Human (GRCh38)
Location 13:80382898-80382920
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864919_1110864928 -5 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864928 13:80382916-80382938 TGTGGGTAAAGGGGAGACCTGGG No data
1110864919_1110864933 21 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864933 13:80382942-80382964 GGTGGTTCCTATCCTGGTTGTGG No data
1110864919_1110864929 0 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864929 13:80382921-80382943 GTAAAGGGGAGACCTGGGCATGG No data
1110864919_1110864932 15 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data
1110864919_1110864934 27 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data
1110864919_1110864930 3 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864930 13:80382924-80382946 AAGGGGAGACCTGGGCATGGTGG No data
1110864919_1110864927 -6 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864927 13:80382915-80382937 CTGTGGGTAAAGGGGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864919 Original CRISPR CCACAGTGTCCTATGGTGGC TGG (reversed) Intergenic