ID: 1110864923

View in Genome Browser
Species Human (GRCh38)
Location 13:80382905-80382927
Sequence CCTTTACCCACAGTGTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864923_1110864933 14 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864933 13:80382942-80382964 GGTGGTTCCTATCCTGGTTGTGG No data
1110864923_1110864934 20 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data
1110864923_1110864929 -7 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864929 13:80382921-80382943 GTAAAGGGGAGACCTGGGCATGG No data
1110864923_1110864930 -4 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864930 13:80382924-80382946 AAGGGGAGACCTGGGCATGGTGG No data
1110864923_1110864932 8 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864923 Original CRISPR CCTTTACCCACAGTGTCCTA TGG (reversed) Intergenic