ID: 1110864932

View in Genome Browser
Species Human (GRCh38)
Location 13:80382936-80382958
Sequence GGGCATGGTGGTTCCTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864917_1110864932 26 Left 1110864917 13:80382887-80382909 CCAGCAGCACACCAGCCACCATA No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data
1110864922_1110864932 11 Left 1110864922 13:80382902-80382924 CCACCATAGGACACTGTGGGTAA No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data
1110864919_1110864932 15 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data
1110864923_1110864932 8 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864932 13:80382936-80382958 GGGCATGGTGGTTCCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864932 Original CRISPR GGGCATGGTGGTTCCTATCC TGG Intergenic