ID: 1110864934

View in Genome Browser
Species Human (GRCh38)
Location 13:80382948-80382970
Sequence TCCTATCCTGGTTGTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110864931_1110864934 -8 Left 1110864931 13:80382933-80382955 CCTGGGCATGGTGGTTCCTATCC No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data
1110864923_1110864934 20 Left 1110864923 13:80382905-80382927 CCATAGGACACTGTGGGTAAAGG No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data
1110864919_1110864934 27 Left 1110864919 13:80382898-80382920 CCAGCCACCATAGGACACTGTGG No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data
1110864922_1110864934 23 Left 1110864922 13:80382902-80382924 CCACCATAGGACACTGTGGGTAA No data
Right 1110864934 13:80382948-80382970 TCCTATCCTGGTTGTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110864934 Original CRISPR TCCTATCCTGGTTGTGGTGT TGG Intergenic