ID: 1110867879

View in Genome Browser
Species Human (GRCh38)
Location 13:80418292-80418314
Sequence TAGTAAAGGCTGCTGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110867879_1110867884 5 Left 1110867879 13:80418292-80418314 CCAGTCTGCAGCAGCCTTTACTA No data
Right 1110867884 13:80418320-80418342 CTAGGATGATCCCACTACTAAGG No data
1110867879_1110867887 21 Left 1110867879 13:80418292-80418314 CCAGTCTGCAGCAGCCTTTACTA No data
Right 1110867887 13:80418336-80418358 ACTAAGGCATGAGCATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110867879 Original CRISPR TAGTAAAGGCTGCTGCAGAC TGG (reversed) Intergenic
No off target data available for this crispr