ID: 1110871310

View in Genome Browser
Species Human (GRCh38)
Location 13:80455407-80455429
Sequence TTGTATTTTTAGTAGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 609819
Summary {0: 98173, 1: 216399, 2: 153384, 3: 81062, 4: 60801}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871310_1110871314 25 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG 0: 103
1: 330
2: 574
3: 1116
4: 2724
1110871310_1110871311 1 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871311 13:80455431-80455453 AATTAGCCCAGCACAGCAGCAGG No data
1110871310_1110871316 26 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 83
1: 384
2: 781
3: 1774
4: 7856
1110871310_1110871317 29 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG 0: 78
1: 283
2: 1966
3: 61223
4: 164445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871310 Original CRISPR TTGTATTTTTAGTAGAGACG AGG (reversed) Intergenic
Too many off-targets to display for this crispr