ID: 1110871311

View in Genome Browser
Species Human (GRCh38)
Location 13:80455431-80455453
Sequence AATTAGCCCAGCACAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871307_1110871311 24 Left 1110871307 13:80455384-80455406 CCAGCCTGGCCAACATGGCGAAA 0: 11522
1: 121075
2: 199735
3: 165608
4: 170514
Right 1110871311 13:80455431-80455453 AATTAGCCCAGCACAGCAGCAGG No data
1110871308_1110871311 20 Left 1110871308 13:80455388-80455410 CCTGGCCAACATGGCGAAACCTC 0: 617
1: 15504
2: 107087
3: 200730
4: 205304
Right 1110871311 13:80455431-80455453 AATTAGCCCAGCACAGCAGCAGG No data
1110871310_1110871311 1 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871311 13:80455431-80455453 AATTAGCCCAGCACAGCAGCAGG No data
1110871309_1110871311 15 Left 1110871309 13:80455393-80455415 CCAACATGGCGAAACCTCGTCTC 0: 330
1: 8660
2: 70337
3: 166190
4: 135137
Right 1110871311 13:80455431-80455453 AATTAGCCCAGCACAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871311 Original CRISPR AATTAGCCCAGCACAGCAGC AGG Intergenic
No off target data available for this crispr