ID: 1110871312

View in Genome Browser
Species Human (GRCh38)
Location 13:80455437-80455459
Sequence CAGGCACCTGCTGCTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871316 -4 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG No data
1110871312_1110871322 9 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG No data
1110871312_1110871324 28 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG No data
1110871312_1110871314 -5 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG No data
1110871312_1110871323 27 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG No data
1110871312_1110871320 5 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871320 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG No data
1110871312_1110871317 -1 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG No data
1110871312_1110871318 2 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871318 13:80455462-80455484 AATCCCAGCTACTTGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871312 Original CRISPR CAGGCACCTGCTGCTGTGCT GGG (reversed) Intergenic