ID: 1110871313

View in Genome Browser
Species Human (GRCh38)
Location 13:80455438-80455460
Sequence ACAGGCACCTGCTGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871313_1110871317 -2 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG 0: 78
1: 283
2: 1966
3: 61223
4: 164445
1110871313_1110871324 27 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871313_1110871320 4 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871320 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713
1110871313_1110871316 -5 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 83
1: 384
2: 781
3: 1774
4: 7856
1110871313_1110871314 -6 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG 0: 103
1: 330
2: 574
3: 1116
4: 2724
1110871313_1110871322 8 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG 0: 263
1: 76944
2: 179089
3: 221980
4: 322234
1110871313_1110871323 26 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1110871313_1110871325 30 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871313_1110871318 1 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871318 13:80455462-80455484 AATCCCAGCTACTTGGGAGGCGG 0: 374
1: 1004
2: 1942
3: 6302
4: 6082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871313 Original CRISPR ACAGGCACCTGCTGCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr