ID: 1110871314

View in Genome Browser
Species Human (GRCh38)
Location 13:80455455-80455477
Sequence GCCTGTAAATCCCAGCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4847
Summary {0: 103, 1: 330, 2: 574, 3: 1116, 4: 2724}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871314 -5 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG 0: 103
1: 330
2: 574
3: 1116
4: 2724
1110871313_1110871314 -6 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG 0: 103
1: 330
2: 574
3: 1116
4: 2724
1110871310_1110871314 25 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871314 13:80455455-80455477 GCCTGTAAATCCCAGCTACTTGG 0: 103
1: 330
2: 574
3: 1116
4: 2724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871314 Original CRISPR GCCTGTAAATCCCAGCTACT TGG Intergenic
Too many off-targets to display for this crispr