ID: 1110871315

View in Genome Browser
Species Human (GRCh38)
Location 13:80455456-80455478
Sequence CCCAAGTAGCTGGGATTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7974
Summary {0: 81, 1: 264, 2: 677, 3: 2333, 4: 4619}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871315_1110871324 9 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871315_1110871325 12 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871315_1110871322 -10 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG 0: 263
1: 76944
2: 179089
3: 221980
4: 322234
1110871315_1110871323 8 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871315 Original CRISPR CCCAAGTAGCTGGGATTTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr