ID: 1110871316

View in Genome Browser
Species Human (GRCh38)
Location 13:80455456-80455478
Sequence CCTGTAAATCCCAGCTACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10878
Summary {0: 83, 1: 384, 2: 781, 3: 1774, 4: 7856}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871316 -4 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 83
1: 384
2: 781
3: 1774
4: 7856
1110871313_1110871316 -5 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 83
1: 384
2: 781
3: 1774
4: 7856
1110871310_1110871316 26 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871316 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 83
1: 384
2: 781
3: 1774
4: 7856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871316 Original CRISPR CCTGTAAATCCCAGCTACTT GGG Intergenic
Too many off-targets to display for this crispr