ID: 1110871317

View in Genome Browser
Species Human (GRCh38)
Location 13:80455459-80455481
Sequence GTAAATCCCAGCTACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227995
Summary {0: 78, 1: 283, 2: 1966, 3: 61223, 4: 164445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871313_1110871317 -2 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG 0: 78
1: 283
2: 1966
3: 61223
4: 164445
1110871312_1110871317 -1 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG 0: 78
1: 283
2: 1966
3: 61223
4: 164445
1110871310_1110871317 29 Left 1110871310 13:80455407-80455429 CCTCGTCTCTACTAAAAATACAA 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
Right 1110871317 13:80455459-80455481 GTAAATCCCAGCTACTTGGGAGG 0: 78
1: 283
2: 1966
3: 61223
4: 164445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871317 Original CRISPR GTAAATCCCAGCTACTTGGG AGG Intergenic
Too many off-targets to display for this crispr