ID: 1110871318

View in Genome Browser
Species Human (GRCh38)
Location 13:80455462-80455484
Sequence AATCCCAGCTACTTGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15704
Summary {0: 374, 1: 1004, 2: 1942, 3: 6302, 4: 6082}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871318 2 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871318 13:80455462-80455484 AATCCCAGCTACTTGGGAGGCGG 0: 374
1: 1004
2: 1942
3: 6302
4: 6082
1110871313_1110871318 1 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871318 13:80455462-80455484 AATCCCAGCTACTTGGGAGGCGG 0: 374
1: 1004
2: 1942
3: 6302
4: 6082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871318 Original CRISPR AATCCCAGCTACTTGGGAGG CGG Intergenic
Too many off-targets to display for this crispr