ID: 1110871319

View in Genome Browser
Species Human (GRCh38)
Location 13:80455465-80455487
Sequence CCTCCGCCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 962720
Summary {0: 391, 1: 96114, 2: 207704, 3: 254239, 4: 404272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871319_1110871329 24 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871329 13:80455512-80455534 GGCAGAGACTGCAGTGAGCTGGG 0: 2
1: 45
2: 624
3: 2485
4: 4264
1110871319_1110871328 23 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871328 13:80455511-80455533 AGGCAGAGACTGCAGTGAGCTGG No data
1110871319_1110871325 3 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871319_1110871330 28 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871330 13:80455516-80455538 GAGACTGCAGTGAGCTGGGATGG No data
1110871319_1110871324 0 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871319_1110871323 -1 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871319 Original CRISPR CCTCCGCCTCCCAAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr