ID: 1110871320

View in Genome Browser
Species Human (GRCh38)
Location 13:80455465-80455487
Sequence CCCAGCTACTTGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 940135
Summary {0: 388, 1: 92154, 2: 204481, 3: 251399, 4: 391713}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871320 5 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871320 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713
1110871313_1110871320 4 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871320 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 388
1: 92154
2: 204481
3: 251399
4: 391713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871320 Original CRISPR CCCAGCTACTTGGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr