ID: 1110871322

View in Genome Browser
Species Human (GRCh38)
Location 13:80455469-80455491
Sequence GCTACTTGGGAGGCGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 800510
Summary {0: 263, 1: 76944, 2: 179089, 3: 221980, 4: 322234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871312_1110871322 9 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG 0: 263
1: 76944
2: 179089
3: 221980
4: 322234
1110871315_1110871322 -10 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG 0: 263
1: 76944
2: 179089
3: 221980
4: 322234
1110871313_1110871322 8 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871322 13:80455469-80455491 GCTACTTGGGAGGCGGAGGCAGG 0: 263
1: 76944
2: 179089
3: 221980
4: 322234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871322 Original CRISPR GCTACTTGGGAGGCGGAGGC AGG Intergenic
Too many off-targets to display for this crispr