ID: 1110871323

View in Genome Browser
Species Human (GRCh38)
Location 13:80455487-80455509
Sequence GCAGGAGAATCGCTTGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432789
Summary {0: 41236, 1: 112059, 2: 146946, 3: 86404, 4: 46144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871313_1110871323 26 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1110871321_1110871323 -2 Left 1110871321 13:80455466-80455488 CCAGCTACTTGGGAGGCGGAGGC 0: 321
1: 83933
2: 194743
3: 240761
4: 326650
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1110871315_1110871323 8 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1110871319_1110871323 -1 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144
1110871312_1110871323 27 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871323 13:80455487-80455509 GCAGGAGAATCGCTTGAACCCGG 0: 41236
1: 112059
2: 146946
3: 86404
4: 46144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871323 Original CRISPR GCAGGAGAATCGCTTGAACC CGG Intergenic
Too many off-targets to display for this crispr