ID: 1110871324

View in Genome Browser
Species Human (GRCh38)
Location 13:80455488-80455510
Sequence CAGGAGAATCGCTTGAACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 688017
Summary {0: 41137, 1: 134699, 2: 211581, 3: 171799, 4: 128801}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871313_1110871324 27 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871315_1110871324 9 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871312_1110871324 28 Left 1110871312 13:80455437-80455459 CCCAGCACAGCAGCAGGTGCCTG No data
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871321_1110871324 -1 Left 1110871321 13:80455466-80455488 CCAGCTACTTGGGAGGCGGAGGC 0: 321
1: 83933
2: 194743
3: 240761
4: 326650
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801
1110871319_1110871324 0 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871324 13:80455488-80455510 CAGGAGAATCGCTTGAACCCGGG 0: 41137
1: 134699
2: 211581
3: 171799
4: 128801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871324 Original CRISPR CAGGAGAATCGCTTGAACCC GGG Intergenic
Too many off-targets to display for this crispr