ID: 1110871325

View in Genome Browser
Species Human (GRCh38)
Location 13:80455491-80455513
Sequence GAGAATCGCTTGAACCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623644
Summary {0: 18679, 1: 97986, 2: 210130, 3: 185373, 4: 111476}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110871321_1110871325 2 Left 1110871321 13:80455466-80455488 CCAGCTACTTGGGAGGCGGAGGC 0: 321
1: 83933
2: 194743
3: 240761
4: 326650
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871313_1110871325 30 Left 1110871313 13:80455438-80455460 CCAGCACAGCAGCAGGTGCCTGT No data
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871315_1110871325 12 Left 1110871315 13:80455456-80455478 CCTGTAAATCCCAGCTACTTGGG 0: 81
1: 264
2: 677
3: 2333
4: 4619
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476
1110871319_1110871325 3 Left 1110871319 13:80455465-80455487 CCCAGCTACTTGGGAGGCGGAGG 0: 391
1: 96114
2: 207704
3: 254239
4: 404272
Right 1110871325 13:80455491-80455513 GAGAATCGCTTGAACCCGGGAGG 0: 18679
1: 97986
2: 210130
3: 185373
4: 111476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110871325 Original CRISPR GAGAATCGCTTGAACCCGGG AGG Intergenic
Too many off-targets to display for this crispr