ID: 1110872008

View in Genome Browser
Species Human (GRCh38)
Location 13:80463282-80463304
Sequence CTGGGGGGTGAGCAGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110872000_1110872008 -1 Left 1110872000 13:80463260-80463282 CCATTATCTGAGATGAAGATGAC No data
Right 1110872008 13:80463282-80463304 CTGGGGGGTGAGCAGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110872008 Original CRISPR CTGGGGGGTGAGCAGGTAGT GGG Intergenic
No off target data available for this crispr