ID: 1110880239

View in Genome Browser
Species Human (GRCh38)
Location 13:80562838-80562860
Sequence CTGTAAGCATAGATCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110880236_1110880239 11 Left 1110880236 13:80562804-80562826 CCATTGCTTTACAGAGGAAGTAT No data
Right 1110880239 13:80562838-80562860 CTGTAAGCATAGATCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110880239 Original CRISPR CTGTAAGCATAGATCAGGCT GGG Intergenic
No off target data available for this crispr