ID: 1110883529

View in Genome Browser
Species Human (GRCh38)
Location 13:80603355-80603377
Sequence AGAATTTGAGATGATGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110883526_1110883529 -7 Left 1110883526 13:80603339-80603361 CCAAATATGCATACCCAGAATTT No data
Right 1110883529 13:80603355-80603377 AGAATTTGAGATGATGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110883529 Original CRISPR AGAATTTGAGATGATGTACA AGG Intergenic
No off target data available for this crispr