ID: 1110889806

View in Genome Browser
Species Human (GRCh38)
Location 13:80684767-80684789
Sequence GAGGGGGAGGAAGGGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889806_1110889817 9 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889806_1110889818 10 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889818 13:80684800-80684822 AATTGTGATGCTGAGGACCTGGG No data
1110889806_1110889822 26 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889822 13:80684816-80684838 ACCTGGGTGGGTACAGAAGGAGG No data
1110889806_1110889824 27 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889824 13:80684817-80684839 CCTGGGTGGGTACAGAAGGAGGG No data
1110889806_1110889816 3 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889806_1110889825 30 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889825 13:80684820-80684842 GGGTGGGTACAGAAGGAGGGAGG No data
1110889806_1110889820 14 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889820 13:80684804-80684826 GTGATGCTGAGGACCTGGGTGGG No data
1110889806_1110889819 13 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889819 13:80684803-80684825 TGTGATGCTGAGGACCTGGGTGG No data
1110889806_1110889821 23 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889806 Original CRISPR GAGGGGGAGGAAGGGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr