ID: 1110889807

View in Genome Browser
Species Human (GRCh38)
Location 13:80684768-80684790
Sequence AGAGGGGGAGGAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37940
Summary {0: 4, 1: 33, 2: 850, 3: 7693, 4: 29360}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889807_1110889817 8 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889807_1110889819 12 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889819 13:80684803-80684825 TGTGATGCTGAGGACCTGGGTGG No data
1110889807_1110889826 30 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889826 13:80684821-80684843 GGTGGGTACAGAAGGAGGGAGGG No data
1110889807_1110889818 9 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889818 13:80684800-80684822 AATTGTGATGCTGAGGACCTGGG No data
1110889807_1110889820 13 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889820 13:80684804-80684826 GTGATGCTGAGGACCTGGGTGGG No data
1110889807_1110889822 25 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889822 13:80684816-80684838 ACCTGGGTGGGTACAGAAGGAGG No data
1110889807_1110889825 29 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889825 13:80684820-80684842 GGGTGGGTACAGAAGGAGGGAGG No data
1110889807_1110889824 26 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889824 13:80684817-80684839 CCTGGGTGGGTACAGAAGGAGGG No data
1110889807_1110889816 2 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889807_1110889821 22 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889807 Original CRISPR AGAGGGGGAGGAAGGGAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr