ID: 1110889810

View in Genome Browser
Species Human (GRCh38)
Location 13:80684776-80684798
Sequence CAAAAAGTAGAGGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889810_1110889820 5 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889820 13:80684804-80684826 GTGATGCTGAGGACCTGGGTGGG No data
1110889810_1110889818 1 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889818 13:80684800-80684822 AATTGTGATGCTGAGGACCTGGG No data
1110889810_1110889817 0 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889810_1110889821 14 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889821 13:80684813-80684835 AGGACCTGGGTGGGTACAGAAGG No data
1110889810_1110889816 -6 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889810_1110889824 18 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889824 13:80684817-80684839 CCTGGGTGGGTACAGAAGGAGGG No data
1110889810_1110889826 22 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889826 13:80684821-80684843 GGTGGGTACAGAAGGAGGGAGGG No data
1110889810_1110889822 17 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889822 13:80684816-80684838 ACCTGGGTGGGTACAGAAGGAGG No data
1110889810_1110889828 29 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889828 13:80684828-80684850 ACAGAAGGAGGGAGGGGCAAAGG No data
1110889810_1110889819 4 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889819 13:80684803-80684825 TGTGATGCTGAGGACCTGGGTGG No data
1110889810_1110889825 21 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889825 13:80684820-80684842 GGGTGGGTACAGAAGGAGGGAGG No data
1110889810_1110889827 23 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889810 Original CRISPR CAAAAAGTAGAGGGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr