ID: 1110889816

View in Genome Browser
Species Human (GRCh38)
Location 13:80684793-80684815
Sequence TTTTTGAAATTGTGATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889801_1110889816 26 Left 1110889801 13:80684744-80684766 CCTCCCTCTCTCCCTCTCTTCTT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889800_1110889816 27 Left 1110889800 13:80684743-80684765 CCCTCCCTCTCTCCCTCTCTTCT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889810_1110889816 -6 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889802_1110889816 23 Left 1110889802 13:80684747-80684769 CCCTCTCTCCCTCTCTTCTTCCC No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889808_1110889816 -2 Left 1110889808 13:80684772-80684794 CCTCCCTTCCTCCCCCTCTACTT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889803_1110889816 22 Left 1110889803 13:80684748-80684770 CCTCTCTCCCTCTCTTCTTCCCT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889811_1110889816 -10 Left 1110889811 13:80684780-80684802 CCTCCCCCTCTACTTTTTGAAAT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889806_1110889816 3 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889804_1110889816 15 Left 1110889804 13:80684755-80684777 CCCTCTCTTCTTCCCTTCCTCCC No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889807_1110889816 2 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889799_1110889816 30 Left 1110889799 13:80684740-80684762 CCTCCCTCCCTCTCTCCCTCTCT 0: 102
1: 1534
2: 8916
3: 19749
4: 38192
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889805_1110889816 14 Left 1110889805 13:80684756-80684778 CCTCTCTTCTTCCCTTCCTCCCT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data
1110889809_1110889816 -5 Left 1110889809 13:80684775-80684797 CCCTTCCTCCCCCTCTACTTTTT No data
Right 1110889816 13:80684793-80684815 TTTTTGAAATTGTGATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889816 Original CRISPR TTTTTGAAATTGTGATGCTG AGG Intergenic
No off target data available for this crispr