ID: 1110889817

View in Genome Browser
Species Human (GRCh38)
Location 13:80684799-80684821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889808_1110889817 4 Left 1110889808 13:80684772-80684794 CCTCCCTTCCTCCCCCTCTACTT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889807_1110889817 8 Left 1110889807 13:80684768-80684790 CCTTCCTCCCTTCCTCCCCCTCT 0: 4
1: 33
2: 850
3: 7693
4: 29360
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889814_1110889817 -9 Left 1110889814 13:80684785-80684807 CCCTCTACTTTTTGAAATTGTGA No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889811_1110889817 -4 Left 1110889811 13:80684780-80684802 CCTCCCCCTCTACTTTTTGAAAT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889810_1110889817 0 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889806_1110889817 9 Left 1110889806 13:80684767-80684789 CCCTTCCTCCCTTCCTCCCCCTC No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889809_1110889817 1 Left 1110889809 13:80684775-80684797 CCCTTCCTCCCCCTCTACTTTTT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889803_1110889817 28 Left 1110889803 13:80684748-80684770 CCTCTCTCCCTCTCTTCTTCCCT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889802_1110889817 29 Left 1110889802 13:80684747-80684769 CCCTCTCTCCCTCTCTTCTTCCC No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889805_1110889817 20 Left 1110889805 13:80684756-80684778 CCTCTCTTCTTCCCTTCCTCCCT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889815_1110889817 -10 Left 1110889815 13:80684786-80684808 CCTCTACTTTTTGAAATTGTGAT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889804_1110889817 21 Left 1110889804 13:80684755-80684777 CCCTCTCTTCTTCCCTTCCTCCC No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889812_1110889817 -7 Left 1110889812 13:80684783-80684805 CCCCCTCTACTTTTTGAAATTGT No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data
1110889813_1110889817 -8 Left 1110889813 13:80684784-80684806 CCCCTCTACTTTTTGAAATTGTG No data
Right 1110889817 13:80684799-80684821 AAATTGTGATGCTGAGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889817 Original CRISPR AAATTGTGATGCTGAGGACC TGG Intergenic
No off target data available for this crispr