ID: 1110889827

View in Genome Browser
Species Human (GRCh38)
Location 13:80684822-80684844
Sequence GTGGGTACAGAAGGAGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110889808_1110889827 27 Left 1110889808 13:80684772-80684794 CCTCCCTTCCTCCCCCTCTACTT No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889813_1110889827 15 Left 1110889813 13:80684784-80684806 CCCCTCTACTTTTTGAAATTGTG No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889814_1110889827 14 Left 1110889814 13:80684785-80684807 CCCTCTACTTTTTGAAATTGTGA No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889815_1110889827 13 Left 1110889815 13:80684786-80684808 CCTCTACTTTTTGAAATTGTGAT No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889812_1110889827 16 Left 1110889812 13:80684783-80684805 CCCCCTCTACTTTTTGAAATTGT No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889811_1110889827 19 Left 1110889811 13:80684780-80684802 CCTCCCCCTCTACTTTTTGAAAT No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889809_1110889827 24 Left 1110889809 13:80684775-80684797 CCCTTCCTCCCCCTCTACTTTTT No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data
1110889810_1110889827 23 Left 1110889810 13:80684776-80684798 CCTTCCTCCCCCTCTACTTTTTG No data
Right 1110889827 13:80684822-80684844 GTGGGTACAGAAGGAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110889827 Original CRISPR GTGGGTACAGAAGGAGGGAG GGG Intergenic
No off target data available for this crispr