ID: 1110900703

View in Genome Browser
Species Human (GRCh38)
Location 13:80819975-80819997
Sequence TTCACTAGTAAGGATGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110900703_1110900709 17 Left 1110900703 13:80819975-80819997 CCAACACCATCCTTACTAGTGAA No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data
1110900703_1110900706 8 Left 1110900703 13:80819975-80819997 CCAACACCATCCTTACTAGTGAA No data
Right 1110900706 13:80820006-80820028 TATTTTTCCCTTATTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110900703 Original CRISPR TTCACTAGTAAGGATGGTGT TGG (reversed) Intergenic
No off target data available for this crispr