ID: 1110900705

View in Genome Browser
Species Human (GRCh38)
Location 13:80819985-80820007
Sequence TACTCAGTCATTCACTAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110900705_1110900709 7 Left 1110900705 13:80819985-80820007 CCTTACTAGTGAATGACTGAGTA No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data
1110900705_1110900706 -2 Left 1110900705 13:80819985-80820007 CCTTACTAGTGAATGACTGAGTA No data
Right 1110900706 13:80820006-80820028 TATTTTTCCCTTATTATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110900705 Original CRISPR TACTCAGTCATTCACTAGTA AGG (reversed) Intergenic
No off target data available for this crispr