ID: 1110900709

View in Genome Browser
Species Human (GRCh38)
Location 13:80820015-80820037
Sequence CTTATTATCAAAGGAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110900702_1110900709 28 Left 1110900702 13:80819964-80819986 CCTACTGCTAGCCAACACCATCC No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data
1110900703_1110900709 17 Left 1110900703 13:80819975-80819997 CCAACACCATCCTTACTAGTGAA No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data
1110900704_1110900709 11 Left 1110900704 13:80819981-80820003 CCATCCTTACTAGTGAATGACTG No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data
1110900705_1110900709 7 Left 1110900705 13:80819985-80820007 CCTTACTAGTGAATGACTGAGTA No data
Right 1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110900709 Original CRISPR CTTATTATCAAAGGAATGTC AGG Intergenic
No off target data available for this crispr