ID: 1110904201

View in Genome Browser
Species Human (GRCh38)
Location 13:80864712-80864734
Sequence CAGTATTTCTTCAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110904201_1110904205 -8 Left 1110904201 13:80864712-80864734 CCATCTTCCTTGAAGAAATACTG No data
Right 1110904205 13:80864727-80864749 AAATACTGCACTGGGTGCAGTGG No data
1110904201_1110904206 19 Left 1110904201 13:80864712-80864734 CCATCTTCCTTGAAGAAATACTG No data
Right 1110904206 13:80864754-80864776 CATCTGTAATCCCAGCACTTTGG 0: 5024
1: 81336
2: 213729
3: 253622
4: 203117
1110904201_1110904207 20 Left 1110904201 13:80864712-80864734 CCATCTTCCTTGAAGAAATACTG No data
Right 1110904207 13:80864755-80864777 ATCTGTAATCCCAGCACTTTGGG 0: 5300
1: 89088
2: 313361
3: 241102
4: 147967
1110904201_1110904208 23 Left 1110904201 13:80864712-80864734 CCATCTTCCTTGAAGAAATACTG No data
Right 1110904208 13:80864758-80864780 TGTAATCCCAGCACTTTGGGCGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1110904201_1110904210 29 Left 1110904201 13:80864712-80864734 CCATCTTCCTTGAAGAAATACTG No data
Right 1110904210 13:80864764-80864786 CCCAGCACTTTGGGCGGCAGAGG 0: 10
1: 5818
2: 209359
3: 261551
4: 183947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110904201 Original CRISPR CAGTATTTCTTCAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr