ID: 1110909588

View in Genome Browser
Species Human (GRCh38)
Location 13:80939842-80939864
Sequence GGTCCCAGTGGACCAATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110909583_1110909588 9 Left 1110909583 13:80939810-80939832 CCAGGTAGTGTACACTAGCACTT No data
Right 1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG No data
1110909580_1110909588 23 Left 1110909580 13:80939796-80939818 CCTGTTCTTGGGCCCCAGGTAGT No data
Right 1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG No data
1110909582_1110909588 10 Left 1110909582 13:80939809-80939831 CCCAGGTAGTGTACACTAGCACT No data
Right 1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG No data
1110909581_1110909588 11 Left 1110909581 13:80939808-80939830 CCCCAGGTAGTGTACACTAGCAC No data
Right 1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110909588 Original CRISPR GGTCCCAGTGGACCAATTTT GGG Intergenic
No off target data available for this crispr