ID: 1110915001

View in Genome Browser
Species Human (GRCh38)
Location 13:81010418-81010440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110915001 Original CRISPR GTACTATTCTAGGATAAAAG TGG Intergenic