ID: 1110917233 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:81036661-81036683 |
| Sequence | TTTCCATAGCTGAAAGTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1110917233_1110917237 | 13 | Left | 1110917233 | 13:81036661-81036683 | CCCTCCACTTTCAGCTATGGAAA | No data | ||
| Right | 1110917237 | 13:81036697-81036719 | GAAAATCAACAAAGAAACATTGG | 0: 163 1: 369 2: 1070 3: 1074 4: 1810 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1110917233 | Original CRISPR | TTTCCATAGCTGAAAGTGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||