ID: 1110917233

View in Genome Browser
Species Human (GRCh38)
Location 13:81036661-81036683
Sequence TTTCCATAGCTGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110917233_1110917237 13 Left 1110917233 13:81036661-81036683 CCCTCCACTTTCAGCTATGGAAA No data
Right 1110917237 13:81036697-81036719 GAAAATCAACAAAGAAACATTGG 0: 163
1: 369
2: 1070
3: 1074
4: 1810

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110917233 Original CRISPR TTTCCATAGCTGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr