ID: 1110919881

View in Genome Browser
Species Human (GRCh38)
Location 13:81069990-81070012
Sequence GTCACCCCTTTGACTAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110919879_1110919881 -10 Left 1110919879 13:81069977-81069999 CCGGGTGCTGTCTGTCACCCCTT 0: 290
1: 1136
2: 1490
3: 870
4: 1137
Right 1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG No data
1110919878_1110919881 -2 Left 1110919878 13:81069969-81069991 CCGATTTTCCGGGTGCTGTCTGT No data
Right 1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG No data
1110919877_1110919881 -1 Left 1110919877 13:81069968-81069990 CCCGATTTTCCGGGTGCTGTCTG No data
Right 1110919881 13:81069990-81070012 GTCACCCCTTTGACTAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110919881 Original CRISPR GTCACCCCTTTGACTAGGAA AGG Intergenic
No off target data available for this crispr