ID: 1110925763

View in Genome Browser
Species Human (GRCh38)
Location 13:81149537-81149559
Sequence TGCCCCCCAGACCCCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110925763_1110925771 28 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925771 13:81149588-81149610 GAAGATAGGAAGATATGATGAGG No data
1110925763_1110925770 14 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925770 13:81149574-81149596 AGGATAGTTATTGGGAAGATAGG No data
1110925763_1110925769 6 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925769 13:81149566-81149588 ATAGGCAGAGGATAGTTATTGGG No data
1110925763_1110925768 5 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925768 13:81149565-81149587 GATAGGCAGAGGATAGTTATTGG No data
1110925763_1110925767 -6 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925767 13:81149554-81149576 GGGGCAGGTTGGATAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110925763 Original CRISPR TGCCCCCCAGACCCCAGCGC AGG (reversed) Intergenic
No off target data available for this crispr