ID: 1110925767

View in Genome Browser
Species Human (GRCh38)
Location 13:81149554-81149576
Sequence GGGGCAGGTTGGATAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110925753_1110925767 27 Left 1110925753 13:81149504-81149526 CCTGGCAAGGAAATAGGAAGAAA No data
Right 1110925767 13:81149554-81149576 GGGGCAGGTTGGATAGGCAGAGG No data
1110925763_1110925767 -6 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925767 13:81149554-81149576 GGGGCAGGTTGGATAGGCAGAGG No data
1110925762_1110925767 -5 Left 1110925762 13:81149536-81149558 CCCTGCGCTGGGGTCTGGGGGGC No data
Right 1110925767 13:81149554-81149576 GGGGCAGGTTGGATAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110925767 Original CRISPR GGGGCAGGTTGGATAGGCAG AGG Intergenic