ID: 1110925767 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:81149554-81149576 |
Sequence | GGGGCAGGTTGGATAGGCAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110925753_1110925767 | 27 | Left | 1110925753 | 13:81149504-81149526 | CCTGGCAAGGAAATAGGAAGAAA | No data | ||
Right | 1110925767 | 13:81149554-81149576 | GGGGCAGGTTGGATAGGCAGAGG | No data | ||||
1110925763_1110925767 | -6 | Left | 1110925763 | 13:81149537-81149559 | CCTGCGCTGGGGTCTGGGGGGCA | No data | ||
Right | 1110925767 | 13:81149554-81149576 | GGGGCAGGTTGGATAGGCAGAGG | No data | ||||
1110925762_1110925767 | -5 | Left | 1110925762 | 13:81149536-81149558 | CCCTGCGCTGGGGTCTGGGGGGC | No data | ||
Right | 1110925767 | 13:81149554-81149576 | GGGGCAGGTTGGATAGGCAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110925767 | Original CRISPR | GGGGCAGGTTGGATAGGCAG AGG | Intergenic | ||