ID: 1110925768

View in Genome Browser
Species Human (GRCh38)
Location 13:81149565-81149587
Sequence GATAGGCAGAGGATAGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110925763_1110925768 5 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925768 13:81149565-81149587 GATAGGCAGAGGATAGTTATTGG No data
1110925762_1110925768 6 Left 1110925762 13:81149536-81149558 CCCTGCGCTGGGGTCTGGGGGGC No data
Right 1110925768 13:81149565-81149587 GATAGGCAGAGGATAGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110925768 Original CRISPR GATAGGCAGAGGATAGTTAT TGG Intergenic