ID: 1110925768 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:81149565-81149587 |
Sequence | GATAGGCAGAGGATAGTTAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110925763_1110925768 | 5 | Left | 1110925763 | 13:81149537-81149559 | CCTGCGCTGGGGTCTGGGGGGCA | No data | ||
Right | 1110925768 | 13:81149565-81149587 | GATAGGCAGAGGATAGTTATTGG | No data | ||||
1110925762_1110925768 | 6 | Left | 1110925762 | 13:81149536-81149558 | CCCTGCGCTGGGGTCTGGGGGGC | No data | ||
Right | 1110925768 | 13:81149565-81149587 | GATAGGCAGAGGATAGTTATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110925768 | Original CRISPR | GATAGGCAGAGGATAGTTAT TGG | Intergenic | ||