ID: 1110925770

View in Genome Browser
Species Human (GRCh38)
Location 13:81149574-81149596
Sequence AGGATAGTTATTGGGAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110925763_1110925770 14 Left 1110925763 13:81149537-81149559 CCTGCGCTGGGGTCTGGGGGGCA No data
Right 1110925770 13:81149574-81149596 AGGATAGTTATTGGGAAGATAGG No data
1110925762_1110925770 15 Left 1110925762 13:81149536-81149558 CCCTGCGCTGGGGTCTGGGGGGC No data
Right 1110925770 13:81149574-81149596 AGGATAGTTATTGGGAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110925770 Original CRISPR AGGATAGTTATTGGGAAGAT AGG Intergenic