ID: 1110937334

View in Genome Browser
Species Human (GRCh38)
Location 13:81307434-81307456
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110937334_1110937342 -6 Left 1110937334 13:81307434-81307456 CCCACCCTAAGGGAAGAATCACA No data
Right 1110937342 13:81307451-81307473 ATCACAGGGAAAGGGACGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110937334 Original CRISPR TGTGATTCTTCCCTTAGGGT GGG (reversed) Intergenic
No off target data available for this crispr