ID: 1110941044

View in Genome Browser
Species Human (GRCh38)
Location 13:81348834-81348856
Sequence ATTTGTAAAAGTCATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110941044_1110941047 17 Left 1110941044 13:81348834-81348856 CCTTCCACATGACTTTTACAAAT No data
Right 1110941047 13:81348874-81348896 CCTTCAGTTTTGCCAAGTATAGG No data
1110941044_1110941048 18 Left 1110941044 13:81348834-81348856 CCTTCCACATGACTTTTACAAAT No data
Right 1110941048 13:81348875-81348897 CTTCAGTTTTGCCAAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110941044 Original CRISPR ATTTGTAAAAGTCATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr