ID: 1110943695

View in Genome Browser
Species Human (GRCh38)
Location 13:81386150-81386172
Sequence TGTCCATCCATTACTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110943690_1110943695 0 Left 1110943690 13:81386127-81386149 CCCTAGCAGTCTGTTCTCTACTC No data
Right 1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG No data
1110943688_1110943695 2 Left 1110943688 13:81386125-81386147 CCCCCTAGCAGTCTGTTCTCTAC No data
Right 1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG No data
1110943689_1110943695 1 Left 1110943689 13:81386126-81386148 CCCCTAGCAGTCTGTTCTCTACT No data
Right 1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG No data
1110943687_1110943695 3 Left 1110943687 13:81386124-81386146 CCCCCCTAGCAGTCTGTTCTCTA No data
Right 1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG No data
1110943691_1110943695 -1 Left 1110943691 13:81386128-81386150 CCTAGCAGTCTGTTCTCTACTCT No data
Right 1110943695 13:81386150-81386172 TGTCCATCCATTACTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110943695 Original CRISPR TGTCCATCCATTACTTTTGG GGG Intergenic
No off target data available for this crispr