ID: 1110948786

View in Genome Browser
Species Human (GRCh38)
Location 13:81458858-81458880
Sequence ACTAGGCTTTTCAGCAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110948784_1110948786 -6 Left 1110948784 13:81458841-81458863 CCAAGGGTCTTGCTATTACTAGG No data
Right 1110948786 13:81458858-81458880 ACTAGGCTTTTCAGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110948786 Original CRISPR ACTAGGCTTTTCAGCAGAAA AGG Intergenic
No off target data available for this crispr