ID: 1110958387

View in Genome Browser
Species Human (GRCh38)
Location 13:81586791-81586813
Sequence AGTTATGTGCAGAAAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110958387_1110958388 -3 Left 1110958387 13:81586791-81586813 CCTGACTTTTTCTGCACATAACT No data
Right 1110958388 13:81586811-81586833 ACTATCTTCATCCTGTCTCTTGG No data
1110958387_1110958389 6 Left 1110958387 13:81586791-81586813 CCTGACTTTTTCTGCACATAACT No data
Right 1110958389 13:81586820-81586842 ATCCTGTCTCTTGGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110958387 Original CRISPR AGTTATGTGCAGAAAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr